IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | AGGCAAGUCAUCCUUGGCUA |
encoded miRNA: | MIR56 |
Precursor location: | 5150 - 5296 (positive strand) |
precursor length: | 147 (41 basepairs) |
MIR position: | 128 - 147 (5277 - 5296) |
MIR length: | 20 (17 paired bases) |
miRNA location TIGR v3: | chr3:9877161>9877307 |
miRNA location TIGR v5: | chr3:9877151>9877297 |
Folding energy: | -37.46 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster008 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UAGCCAAAGA GACUGCCUGA AACCUAACCC GCAAGAUUCA ACAUGAUCUC AAAUUAUUAU 60 (((((((-(( (((((((((( ------(((- -((-(((((( (,,<<____> >,<<<<<<<< ACCUUUUAAA CGCAUAAUAA UCCAAAAUCC ACGAACUUAA AAUUGAAUCA UGGAGGUGAA 120 __________ ___>>>>>>> >,,,,,,,,, ,,,,,,,,,, ,,)))))))- ))--)))--- *** ********** ******* AAAGAUCAGG CAAGUCAUCC UUGGCUA 147 -----))))) )-))))-))- )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54150.1 | 68408.m05663 zinc finger (C3HC4-type RING finger) protein family | 2 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2510_67224-67328_1-20
- gnl|BL_ORD_ID|2510_67224+67328_86-105
- gnl|BL_ORD_ID|2154_158032-158181_1-20
- gnl|BL_ORD_ID|2154_158032+158181_131-150
- gnl|BL_ORD_ID|323_84895+85044_131-150
- gnl|BL_ORD_ID|323_84895-85044_1-20