IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | UGGUAGCCAAGGAUGACUUGCCU |
encoded miRNA: | MIR43c |
Precursor location: | 4804 - 4934 (negative strand) |
precursor length: | 131 (49 basepairs) |
MIR position: | 1 - 23 (4912 - 4934) |
MIR length: | 23 (20 paired bases) |
miRNA location TIGR v3: | chr3:9876815<9876945 |
miRNA location TIGR v5: | chr3:9876805<9876935 |
Folding energy: | -56.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** UGGUAGCCAA GGAUGACUUG CCUGCUUCUC UGAACAAAAU GGUCGAUGUC AUGUUUUGAA 60 :((((((((( (((-((((-( ((((--(((- (((((((((( (((((----- ---(((((-- GUGACUAUAA GUUAUACCAA GAAAUGACCA UUUUGUUUAU AAAUAGACAU CAGGCAGUCU 120 (((((_____ )))))--))) ))--)))))) )))))))))- ----)))--- )))))))))) CCUUGGCUAU C 131 )))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g17590.1 | 68408.m01959 transcription factor -related | 3 | 10 |
2 | At1g72830.1 | 68408.m07728 CCAAT-binding factor B subunit homolog -related | 3 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2510_67219-67328_1-23
- gnl|BL_ORD_ID|2510_67219+67328_88-110