IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | UGGUAGCCAAGGAUGACUUGCCUG |
encoded miRNA: | MIR43b |
Precursor location: | 4804 - 4934 (negative strand) |
precursor length: | 131 (49 basepairs) |
MIR position: | 1 - 24 (4911 - 4934) |
MIR length: | 24 (21 paired bases) |
miRNA location TIGR v3: | chr3:9876815<9876945 |
miRNA location TIGR v5: | chr3:9876805<9876935 |
Folding energy: | -56.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** **** UGGUAGCCAA GGAUGACUUG CCUGCUUCUC UGAACAAAAU GGUCGAUGUC AUGUUUUGAA 60 :((((((((( (((-((((-( ((((--(((- (((((((((( (((((----- ---(((((-- GUGACUAUAA GUUAUACCAA GAAAUGACCA UUUUGUUUAU AAAUAGACAU CAGGCAGUCU 120 (((((_____ )))))--))) ))--)))))) )))))))))- ----)))--- )))))))))) CCUUGGCUAU C 131 )))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g17590.1 | 68408.m01959 transcription factor -related | 4 | 10 |
2 | At1g72830.1 | 68408.m07728 CCAAT-binding factor B subunit homolog -related | 4 | 8 |
Rice homologs
- gnl|BL_ORD_ID|3514_19522-19630_1-24
- gnl|BL_ORD_ID|3514_19522+19630_86-109
- gnl|BL_ORD_ID|3443_19522-19630_1-24
- gnl|BL_ORD_ID|3443_19522+19630_86-109
- gnl|BL_ORD_ID|2878_55661+55769_86-109
- gnl|BL_ORD_ID|2878_55661-55769_1-24
- gnl|BL_ORD_ID|2113_130006-130127_1-24
- gnl|BL_ORD_ID|2113_130006+130127_99-122
- gnl|BL_ORD_ID|2113_123474-123579_1-24
- gnl|BL_ORD_ID|2113_119287-119379_1-24
- gnl|BL_ORD_ID|990_69301-69422_1-24
- gnl|BL_ORD_ID|990_69301+69422_99-122
- gnl|BL_ORD_ID|990_62769-62874_1-24
- gnl|BL_ORD_ID|990_58582-58674_1-24