IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | AGGCAAGUCAUCCUUGGCUAC |
encoded miRNA: | MIR12 |
Precursor location: | 1594 - 1740 (positive strand) |
precursor length: | 147 (49 basepairs) |
MIR position: | 127 - 147 (1720 - 1740) |
MIR length: | 21 (18 paired bases) |
miRNA location TIGR v3: | chr3:9873605>9873751 |
miRNA location TIGR v5: | chr3:9873595>9873741 |
Folding energy: | -52.24 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster008 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UAGCCAAGGA GACUGCCUGA AACCUAACCC GCAAGAUUCA ACAUGAUUUC AAAUUAUUAU 60 (((((((((( (((((((((( ------(((- -((-(((((( (((((-(((- --(((((((( ACUUUUGAAU GUAUAAUAAU CCAAAACCCA UGAAUUACAA AUUGAAUCAU GGAGGUGAAA 120 ((________ )))))))))) ---)))--)) ))-------- -)))))))-) )--)))---- **** ********** ******* AAGAUCAGGC AAGUCAUCCU UGGCUAC 147 ----)))))) -))))-)))) )))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54150.1 | 68408.m05663 zinc finger (C3HC4-type RING finger) protein family | 2 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2510_67223-67328_1-21
- gnl|BL_ORD_ID|2510_67223+67328_86-106
- gnl|BL_ORD_ID|2154_158030-158181_1-21
- gnl|BL_ORD_ID|2154_158031+158181_131-151
- gnl|BL_ORD_ID|323_84895+85045_131-151
- gnl|BL_ORD_ID|323_84894-85045_1-21