IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | CAGGCAAGUCAUCCUUGGCUAC |
encoded miRNA: | MIR12a |
Precursor location: | 1594 - 1740 (positive strand) |
precursor length: | 147 (49 basepairs) |
MIR position: | 126 - 147 (1719 - 1740) |
MIR length: | 22 (19 paired bases) |
miRNA location TIGR v3: | chr3:9873605>9873751 |
miRNA location TIGR v5: | chr3:9873595>9873741 |
Folding energy: | -52.24 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster008 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UAGCCAAGGA GACUGCCUGA AACCUAACCC GCAAGAUUCA ACAUGAUUUC AAAUUAUUAU 60 (((((((((( (((((((((( ------(((- -((-(((((( (((((-(((- --(((((((( ACUUUUGAAU GUAUAAUAAU CCAAAACCCA UGAAUUACAA AUUGAAUCAU GGAGGUGAAA 120 ((________ )))))))))) ---)))--)) ))-------- -)))))))-) )--)))---- ***** ********** ******* AAGAUCAGGC AAGUCAUCCU UGGCUAC 147 ----)))))) -))))-)))) )))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54150.1 | 68408.m05663 zinc finger (C3HC4-type RING finger) protein family | 3 | 8 |
Rice homologs
- gnl|BL_ORD_ID|3514_19526-19630_1-22
- gnl|BL_ORD_ID|3514_19526+19630_84-105
- gnl|BL_ORD_ID|3443_19526-19630_1-22
- gnl|BL_ORD_ID|3443_19526+19630_84-105
- gnl|BL_ORD_ID|2878_55663+55767_84-105
- gnl|BL_ORD_ID|2878_55663-55767_1-22
- gnl|BL_ORD_ID|2113_123478-123579_1-22
- gnl|BL_ORD_ID|2113_119291-119379_1-22
- gnl|BL_ORD_ID|2113_119291+119379_68-89
- gnl|BL_ORD_ID|2113_130010-130127_1-22
- gnl|BL_ORD_ID|2113_130010+130127_97-118
- gnl|BL_ORD_ID|990_62773-62874_1-22
- gnl|BL_ORD_ID|990_58586-58674_1-22
- gnl|BL_ORD_ID|990_58586+58674_68-89
- gnl|BL_ORD_ID|990_69305-69422_1-22
- gnl|BL_ORD_ID|990_69305+69422_97-118