IGR sequence: | igr2174#chr5#x1=9803029#l=11421 |
---|---|
Mature miRNA sequence: | UGGAGAAGCAGGGCACGUGC |
encoded miRNA: | MIR82 |
Precursor location: | 8580 - 8661 (positive strand) |
precursor length: | 82 (27 basepairs) |
MIR position: | 1 - 20 (8580 - 8599) |
MIR length: | 20 (17 paired bases) |
miRNA location TIGR v3: | chr5:9811608>9811689 |
miRNA location TIGR v5: | chr5:9852688>9852769 |
Folding energy: | -34.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster026 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** UGGAGAAGCA GGGCACGUGC GAACACAAAU GAAAUCGAUC GGUACUUGUU GAUCAUAUUU 60 :((((-((-( (((((((((( (((,,<____ >,,,,,<<<< <<______>> >>>>,,,,,) UCGCACGUGU UCUACUACUC CA 82 )))))))))) )))-))-))) ):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g56010.1 | 68408.m05888 NAC1 / No apical meristem (NAM) protein family | 1 | 2 |
2 | At1g56010.2 | 68408.m05889 NAC1 / No apical meristem (NAM) protein family | 1 | 2 |
3 | At3g15170.1 | 68410.m01722 NAM-related protein | 2 | 1 |
4 | At5g07680.1 | 68412.m00813 NAM (no apical meristem)-related protein | 2 | 2 |
5 | At5g07680.2 | 68412.m00814 NAM (no apical meristem)-related protein | 2 | 2 |
6 | At5g53950.1 | 68412.m06069 No apical meristem (NAM) protein CUC2 | 2 | 1 |
7 | At5g61430.1 | 68412.m06973 NAM, no apical meristem, - like protein | 2 | 2 |
Rice homologs
- gnl|BL_ORD_ID|3113_155064-155156_74-93
- gnl|BL_ORD_ID|3113_155064+155156_1-20
- gnl|BL_ORD_ID|968_113710+113831_1-20
- gnl|BL_ORD_ID|968_113710-113831_103-122
- gnl|BL_ORD_ID|396_77782-77855_55-74
- gnl|BL_ORD_ID|396_77782+77855_1-20