At5g07680.1

At5g07680.1 68412.m00813 NAM (no apical meristem)-related protein

Matching miRNAs:
miRNA nameIGR namemature miRNA sequenceTargetsRfam
1prec14624igr4203#chr2#x1=19467319#l=3008_1907+1988GTTGGAGAAGCAGGGCACGTGCA5ath-MIR164a
2prec4152igr2174#chr5#x1=9803029#l=11421_8580+8661TGGAGAAGCAGGGCACGTGC7

Gene Sequence:

aacuucucuu ucaccuuuac ucucucuauc ucucuuacau auaucuauau auauucccug     60 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

aacccaucuc uugaaaacau ucaagaucaa aucuuucucg aucuauucaa agaaaaacua    120 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

uuuaagaaac auauguuuug gaucaaguaa ggguuugauc uuguaccgga aucagguuuu    180 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

ugcuuuucuu cuaggguuua agguuauuua aaaacagAUG GAAACUUUCG GUGUGUUUCA    240 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

CAAGGAAGAU GAUGAGCAGA UGGAUUUGCC UCCUGGUUUU AGGUUUCAUC CAACAGACGA    300 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

AGAACUCAUA ACCCACUAUC UCCACAAGAA GGUUCUUGAC CUUGGUUUCU CGGCUAAAGC    360 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

UAUUGGUGAG GUUGAUUUGA ACAAAGCUGA GCCAUGGGAG UUGCCAUAUA AAGCAAAAAU    420 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

UGGUGAGAAA GAAUGGUACU UUUUCUGUGU GAGGGAUAGA AAGUAUCCGA CUGGUCUGAG    480 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

GACUAACCGA GCAACUCAAG CCGGUUAUUG GAAGGCGACA GGGAAGGAUA AAGAGAUCUU    540 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

CCGAGGCAAA UCGCUUGUUG GUAUGAAGAA AACACUUGUU UUCUACAGAG GAAGAGCUCC    600 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

UAAAGGCCAG AAAACAAAUU GGGUGAUGCA UGAGUAUAGG CUAGAUGGAA AACUCUCUGC    660 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

UCACAACUUG CCUAAAACCG CUAAGAAUGA AUGGGUGAUC UGCAGGGUAU UUCAUAAAAC    720 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

UGCUGGAGGU AAGAAGAUCC CGAUUUCGAC GUUAAUCCGA AUCGGUUCUU ACGGAACCGG    780 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

GUCUAGUUUA CCACCUUUAA CUGAUUCUUC ACCAUACAAC GACAAAACCA AGACCGAACC    840 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

AGUUUACGUG CCCUGCUUCU CCAACCAAGC UGAAACUAGA GGAACAAUAC UCAAUUGCUU    900 
..******** ********** *****..... .......... .......... ..........        prec14624
...******* ********** ***....... .......... .......... ..........        prec4152

CAGCAACCCU UCCCUUAGCU CCAUCCAACC AGAUUUUCUC CAGAUGAUUC CACUCUACCA    960 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

ACCUCAAUCU CUCAACAUUU CCGAGAGUUC CAAUCCGGUU CUUACGCAAG AACAAUCAGU   1020 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

UUUACAAGCG AUGAUGGAAA ACAACAGAAG GCAGAACUUC AAAACAUUGA GCAUCUCGCA   1080 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

AGAAACCGGG GUUUCGAACA CCGAUAACUC AUCGGUUUUU GAAUUUGGGA GGAAGCGAUU   1140 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

UGAUCAUCAA GAAGUUCCAU CUCCCUCUUC CGGUCCGGUU GAUCUUGAAC CUUUCUGGAA   1200 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

UUACUGAaga uucagaaccu gaaaagucua uuaauuuagg ucacaaguaa gaaaaucuuu   1260 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

gcaaaguuuu auccuuuuag cguggugugc uaagcuugua uagauuauug acacuacuuc   1320 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

cuguauuagu guuuuauauu auuauauuca acuaaaguua auauuagaga ggauaaaaug   1380 
.......... .......... .......... .......... .......... ..........        prec14624
.......... .......... .......... .......... .......... ..........        prec4152

aagc  1384 
....       prec14624
....       prec4152