IGR sequence: | igr2011#chr4#x1=10447721#l=2403 |
---|---|
Mature miRNA sequence: | CCGGCAAGUCAUCCUUGGCU |
encoded miRNA: | MIR76 |
Precursor location: | 320 - 398 (positive strand) |
precursor length: | 79 (26 basepairs) |
MIR position: | 60 - 79 (379 - 398) |
MIR length: | 20 (17 paired bases) |
miRNA location TIGR v3: | chr4:10448040>10448118 |
miRNA location TIGR v5: | chr4:11483046>11483124 |
Folding energy: | -34.40 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster008 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
* AGCCAAGGUC AACUUGCCGG ACACCAGAAU CAGUUAAUUA GAUUCAUUGG UAAAAAAACC 60 ((((((((-- -((((((((( --(((((((( (_________ )))))--))) )--------) ********** ********* CGGCAAGUCA UCCUUGGCU 79 ))))))))-- -))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54150.1 | 68408.m05663 zinc finger (C3HC4-type RING finger) protein family | 2 | 8 |
Rice homologs
- gnl|BL_ORD_ID|3091_167854+167959_87-106
- gnl|BL_ORD_ID|3091_167854-167959_1-20
- gnl|BL_ORD_ID|2404_2611-2700_1-20
- gnl|BL_ORD_ID|2404_2611+2700_71-90
- gnl|BL_ORD_ID|2314_13778+13867_71-90
- gnl|BL_ORD_ID|2314_13778-13867_1-20
- gnl|BL_ORD_ID|1188_62445+62548_85-104
- gnl|BL_ORD_ID|1181_130578-130683_1-20
- gnl|BL_ORD_ID|1181_130578+130683_87-106