IGR sequence: | igr1929#chr5#x1=8503345#l=5327 |
---|---|
Mature miRNA sequence: | CGGCAAGUCAUCCUUGGCUGCA |
encoded miRNA: | MIR80 |
Precursor location: | 1912 - 2016 (negative strand) |
precursor length: | 105 (37 basepairs) |
MIR position: | 84 - 105 (1912 - 1933) |
MIR length: | 22 (18 paired bases) |
miRNA location TIGR v3: | chr5:8505256<8505360 |
miRNA location TIGR v5: | chr5:8527512<8527616 |
Folding energy: | -37.50 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster008 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UGUAGCCGAA GGACAACUUG CCAGAAAUAU GUUCAUCACA UAAUUAAUCA UCACAUUAUU 60 :((((((-(( (((--((((( ((-(((---( (((-(((((( ((--((((__ ____))))-- ******* ********** ***** CAUAUGCAUG GUUAACAACG UUCCGGCAAG UCAUCCUUGG CUGCA 105 --))))--)) ))-))))--- )))-)))))) )--))))))) )))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54150.1 | 68408.m05663 zinc finger (C3HC4-type RING finger) protein family | 3 | 8 |
Rice homologs
- gnl|BL_ORD_ID|430_45596+45694_1-22