IGR sequence: | igr1929#chr5#x1=8503345#l=5327 |
---|---|
Mature miRNA sequence: | CCGGCAAGUCAUCCUUGGCUGCAU |
encoded miRNA: | MIR80a |
Precursor location: | 1911 - 2017 (negative strand) |
precursor length: | 107 (39 basepairs) |
MIR position: | 84 - 107 (1911 - 1934) |
MIR length: | 24 (21 paired bases) |
miRNA location TIGR v3: | chr5:8505255<8505361 |
miRNA location TIGR v5: | chr5:8527511<8527617 |
Folding energy: | -38.50 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster008 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
AUGUAGCCGA AGGACAACUU GCCAGAAAUA UGUUCAUCAC AUAAUUAAUC AUCACAUUAU 60 ((((((((-( ((((--(((( (((-(((--- ((((-((((( (((--((((_ _____))))- ******* ********** ******* UCAUAUGCAU GGUUAACAAC GUUCCGGCAA GUCAUCCUUG GCUGCAU 107 ---))))--) )))-))))-- -)))-))))) ))--)))))) )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54150.1 | 68408.m05663 zinc finger (C3HC4-type RING finger) protein family | 4 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2404_2677+2773_1-24
- gnl|BL_ORD_ID|2404_2677-2774_75-98
- gnl|BL_ORD_ID|2314_13848-13945_75-98
- gnl|BL_ORD_ID|2314_13848+13944_1-24
- gnl|BL_ORD_ID|1188_62525-62636_89-112