IGR sequence: | igr1929#chr5#x1=8503345#l=5327 |
---|---|
Mature miRNA sequence: | AUGCAGCCAAGGAUGACUUGCCGG |
encoded miRNA: | MIR81b |
Precursor location: | 1911 - 2017 (positive strand) |
precursor length: | 107 (41 basepairs) |
MIR position: | 1 - 24 (1911 - 1934) |
MIR length: | 24 (21 paired bases) |
miRNA location TIGR v3: | chr5:8505255>8505361 |
miRNA location TIGR v5: | chr5:8527511>8527617 |
Folding energy: | -46.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** **** AUGCAGCCAA GGAUGACUUG CCGGAACGUU GUUAACCAUG CAUAUGAAUA AUGUGAUGAU 60 (((-(((((( (((--((((( ((((((---( (((---(((- (((((((-(( ((______)) UAAUUAUGUG AUGAACAUAU UUCUGGCAAG UUGUCCUUCG GCUACAU 107 ))-))))))) )))))))--- )))))))))) )--)))))-) )))-)))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54160.1 | 68408.m05664 CCAAT-binding factor B subunit -related | 4 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2404_2677+2773_1-24
- gnl|BL_ORD_ID|2404_2677-2774_75-98
- gnl|BL_ORD_ID|2314_13848-13945_75-98
- gnl|BL_ORD_ID|2314_13848+13944_1-24
- gnl|BL_ORD_ID|1188_62525-62636_89-112