IGR sequence: | igr1679#chr4#x1=8848676#l=7609 |
---|---|
Mature miRNA sequence: | GUGCCUGGCUCCCUGUAUGCCAC |
encoded miRNA: | MIR75c |
Precursor location: | 5317 - 5399 (positive strand) |
precursor length: | 83 (31 basepairs) |
MIR position: | 1 - 23 (5317 - 5339) |
MIR length: | 23 (21 paired bases) |
miRNA location TIGR v3: | chr4:8853992>8854074 |
miRNA location TIGR v5: | chr4:9888998>9889080 |
Folding energy: | -35.80 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR160b |
Belongs to miRNAs-targets cluster: | cluster017 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** GUGCCUGGCU CCCUGUAUGC CACAAGAAAA CAUCGAUUUA GUUUCAAAAU CGAUCACUAG 60 ((((-((((( -((((((((( (((-((---- -((((((((_ ______)))) ))))--))-) UGGCGUACAG AGUAGUCAAG CAU 83 )))))))))) -)-)))))-) )))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g77850.1 | 68408.m08325 transcriptional factor B3 family | 3 | 7 |
Rice homologs
- gnl|BL_ORD_ID|1294_49758+49846_1-23
- gnl|BL_ORD_ID|727_84919+85007_1-23