IGR sequence: | igr922#chr3#x1=3597929#l=5132 |
---|---|
Mature miRNA sequence: | AUGAGAAUCUUGAUGAUGCUGCA |
encoded miRNA: | MIR21 |
Precursor location: | 1870 - 1970 (negative strand) |
precursor length: | 101 (37 basepairs) |
MIR position: | 79 - 101 (1870 - 1892) |
MIR length: | 23 (19 paired bases) |
miRNA location TIGR v3: | chr3:3599798<3599898 |
miRNA location TIGR v5: | chr3:3599798<3599898 |
Folding energy: | -37.40 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster011 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UGGAGCAUCA UCAAGAUUCA CAAAUCAUCA AGUAUUCGUG UAAAUAAACC CAUUUAUGAU 60 :(-((((((( (((((((((- ((-((((((( ((---((-(( (((((_____ _)))))))-- ** ********** ********** * UAGAUUUUUG AUGUAUGUAU GAGAAUCUUG AUGAUGCUGC A 101 --))--)))) )))-))---) )-)))))))) ))))))))-) :
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g28550.1 | 68409.m03139 AP2 domain transcription factor RAP2.7 | 3 | 2 |
2 | At4g36920.1 | 68411.m04757 floral homeotic protein APETALA2 | 3 | 3 |
3 | At5g12900.1 | 68412.m01364 expressed protein | 3 | 1 |
4 | At5g60120.1 | 68412.m06823 AP2 domain transcription factor, putative | 2 | 3 |
Rice homologs
- gnl|BL_ORD_ID|311_87588-87677_68-90
- gnl|BL_ORD_ID|311_87588+87677_1-23