IGR sequence: | igr1621#chr1#x1=6694921#l=2247 |
---|---|
Mature miRNA sequence: | AGGCAAGUCAUCCUUGGCUACC |
encoded miRNA: | MIR44 |
Precursor location: | 535 - 637 (positive strand) |
precursor length: | 103 (34 basepairs) |
MIR position: | 82 - 103 (616 - 637) |
MIR length: | 22 (18 paired bases) |
miRNA location TIGR v3: | chr1:6695455>6695557 |
miRNA location TIGR v5: | chr1:6695455>6695557 |
Folding energy: | -45.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster008 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UAGCCAAGGA GACUGCCUGA CGACCAACCA ACUCUAAGAC UAUCGAUCGA GUGAGUCUUU 60 (((((((((( (((((((((- -(((((---- --((-((((( (-((____)) ---))))))- ********* ********** *** GAUAUAUAUG GUCUAAAACG CAGGCAAGUC AUCCUUGGCU ACC 103 ))------)) )))------- )))))-)))) -))))))))) )::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54150.1 | 68408.m05663 zinc finger (C3HC4-type RING finger) protein family | 3 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2154_158028-158181_1-22
- gnl|BL_ORD_ID|2154_158030+158181_131-152
- gnl|BL_ORD_ID|323_84895+85046_131-152
- gnl|BL_ORD_ID|323_84893-85046_1-22