IGR sequence: | igr5553#chr1#x1=25868910#l=5170 |
---|---|
Mature miRNA sequence: | UGAAGUGUUUGGGGGAACUC |
encoded miRNA: | MIR64 |
Precursor location: | 871 - 950 (negative strand) |
precursor length: | 80 (29 basepairs) |
MIR position: | 61 - 80 (871 - 890) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr1:25869780<25869859 |
miRNA location TIGR v5: | chr1:26273652<26273731 |
Folding energy: | -39.50 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster030 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GAGUUCUCCU GAACACUUCA UUGGAAAUUU GUUAUUCAGU AAGCUAACAG UUAAUUCCAC 60 (((((((((- -((((((((( -(((((--(( ((((______ ____)))))) ----)))))- ********** ********** UGAAGUGUUU GGGGGAACUC 80 )))))))))- -)))))))))
![](../images/prec17162.png)
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g28780.1 | 68409.m03167 expressed protein | 2 | 1 |
2 | At3g22890.1 | 68410.m02623 ATP sulfurylase -related | 2 | 1 |
3 | At4g14680.1 | 68411.m02044 ATP-sulfurylase | 2 | 1 |
4 | At5g10180.1 | 68412.m01087 sulfate transporter | 2 | 1 |
5 | At5g43780.1 | 68412.m04828 ATP sulfurylase precursor (gb|AAD26634.1) | 1 | 2 |
Rice homologs
- gnl|BL_ORD_ID|2328_172534+172815_1-20
- gnl|BL_ORD_ID|2319_12130+12411_1-20
- gnl|BL_ORD_ID|2693_32562-32911_331-350
- gnl|BL_ORD_ID|2693_32562-32629_49-68
- gnl|BL_ORD_ID|2693_32562+32629_1-20
- gnl|BL_ORD_ID|2693_32562+32911_1-20
- gnl|BL_ORD_ID|2693_32278-32343_47-66
- gnl|BL_ORD_ID|2693_32278+32593_1-20
- gnl|BL_ORD_ID|2693_32705-32772_49-68
- gnl|BL_ORD_ID|2693_32705-32915_192-211
- gnl|BL_ORD_ID|2693_32705+32772_1-20
- gnl|BL_ORD_ID|2693_32705+32915_1-20
- gnl|BL_ORD_ID|2693_32848-33201_335-354
- gnl|BL_ORD_ID|2693_32848-33058_192-211
- gnl|BL_ORD_ID|2693_32848-32915_49-68
- gnl|BL_ORD_ID|2693_32848+33058_1-20
- gnl|BL_ORD_ID|2693_32848+33201_1-20
- gnl|BL_ORD_ID|2437_51501-51850_331-350
- gnl|BL_ORD_ID|2437_51501-51568_49-68
- gnl|BL_ORD_ID|2437_51501+51850_1-20
- gnl|BL_ORD_ID|2437_51501+51568_1-20
- gnl|BL_ORD_ID|2437_51217-51282_47-66
- gnl|BL_ORD_ID|2437_51217+51532_1-20
- gnl|BL_ORD_ID|2437_51644-51711_49-68
- gnl|BL_ORD_ID|2437_51644-51854_192-211
- gnl|BL_ORD_ID|2437_51644+51711_1-20
- gnl|BL_ORD_ID|2437_51644+51854_1-20
- gnl|BL_ORD_ID|2437_51787-52140_335-354
- gnl|BL_ORD_ID|2437_51787-51997_192-211
- gnl|BL_ORD_ID|2437_51787-51854_49-68
- gnl|BL_ORD_ID|2437_51787+51997_1-20
- gnl|BL_ORD_ID|2437_51787+52140_1-20
- gnl|BL_ORD_ID|986_78821+79087_1-20
- gnl|BL_ORD_ID|986_78821-79087_248-267
- gnl|BL_ORD_ID|986_78821-78912_73-92
- gnl|BL_ORD_ID|986_79331+79422_1-20
- gnl|BL_ORD_ID|986_79331+79582_1-20
- gnl|BL_ORD_ID|986_79331-79582_233-252
- gnl|BL_ORD_ID|986_79331-79422_73-92
- gnl|BL_ORD_ID|986_79171+79422_1-20
- gnl|BL_ORD_ID|986_79171-79247_58-77
- gnl|BL_ORD_ID|986_79171-79422_233-252
- gnl|BL_ORD_ID|986_79504+79757_1-20
- gnl|BL_ORD_ID|986_79504-79582_60-79
- gnl|BL_ORD_ID|986_79504-79757_235-254
- gnl|BL_ORD_ID|986_79666-79757_73-92
- gnl|BL_ORD_ID|986_78996+79087_1-20
- gnl|BL_ORD_ID|986_78996-79247_233-252
- gnl|BL_ORD_ID|986_78996-79087_73-92