IGR sequence: | igr5124#chr5#x1=24569732#l=3135 |
---|---|
Mature miRNA sequence: | UGCCAAAGGAGAGUUGCCCU |
encoded miRNA: | MIR16 |
Precursor location: | 933 - 1024 (positive strand) |
precursor length: | 92 (31 basepairs) |
MIR position: | 73 - 92 (1005 - 1024) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr5:24570664>24570755 |
miRNA location TIGR v5: | chr5:24979722>24979813 |
Folding energy: | -41.99 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster020 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
AGGGCAUCUU UCUAUUGGCA GGCGACUUGG CUAUUUGUAU CUUUUGUGUU CUUGACUAUU 60 ((((((-((( (((-(((((( ((-(((-((( (((---((__ __________ ____))---) ******** ********** ** GGCUAUGUCA CUUGCCAAAG GAGAGUUGCC CU 92 )))))-)))- ))))))))-) )))))-)))) ))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
2 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
3 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
4 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
Rice homologs
- gnl|BL_ORD_ID|2430_58466+58549_65-84
- gnl|BL_ORD_ID|2430_58466-58549_1-20