IGR sequence: | igr4897#chr5#x1=23595489#l=2752 |
---|---|
Mature miRNA sequence: | GUGGGAAUCUUGAUGAUGCUGCAUC |
encoded miRNA: | MIR84 |
Precursor location: | 1161 - 1267 (positive strand) |
precursor length: | 107 (39 basepairs) |
MIR position: | 83 - 107 (1243 - 1267) |
MIR length: | 25 (22 paired bases) |
miRNA location TIGR v3: | chr5:23596649>23596755 |
miRNA location TIGR v5: | chr5:24005707>24005813 |
Folding energy: | -49.60 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster011 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GAUGCAGCAC CAUUAAGAUU CACAAGAGAU GUGGUUCCCU UUGCUUUCGC CUCUCGAUCC 60 (((((((((- (((((((((( (-((---((( (-((--(((( ((((--(((_ ____)))--- ******** ********** ******* GCAGAAAAGG GUUCCUUAUC GAGUGGGAAU CUUGAUGAUG CUGCAUC 107 )))---)))) )--))-)))) ---))-)))) )))))))-)) )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g28550.1 | 68409.m03139 AP2 domain transcription factor RAP2.7 | 4 | 2 |
2 | At4g36920.1 | 68411.m04757 floral homeotic protein APETALA2 | 4 | 3 |
3 | At5g60120.1 | 68412.m06823 AP2 domain transcription factor, putative | 3 | 3 |
Rice homologs
- gnl|BL_ORD_ID|1572_16787-17006_1-25
- gnl|BL_ORD_ID|526_109642-109861_1-25