IGR sequence: | igr1201#chr3#x1=4804107#l=2637 |
---|---|
Mature miRNA sequence: | CCGGCAAGUCAUCCUUGGCU |
encoded miRNA: | MIR76 |
Precursor location: | 1618 - 1718 (positive strand) |
precursor length: | 101 (33 basepairs) |
MIR position: | 82 - 101 (1699 - 1718) |
MIR length: | 20 (15 paired bases) |
miRNA location TIGR v3: | chr3:4805724>4805824 |
miRNA location TIGR v5: | chr3:4805724>4805824 |
Folding energy: | -41.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster008 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
AGCCAAGGUC AACUUGCCAG ACACGAAUCA ACAGAUUGUG AAUGAGACCA AAUCAAUGGU 60 ((((((((-- -(((((((,, ,<<<-<<<<_ ___>>>>>>> ,,,,,<<<<< ______>>>> ********* ********** * CAUAAACCGG UUGGGUUUAA ACCGGCAAGU CAUCCUUGGC U 101 >,<<<<<<__ ___>>>>>>, ,,,))))))) ---))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54150.1 | 68408.m05663 zinc finger (C3HC4-type RING finger) protein family | 2 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2404_2611-2700_1-20
- gnl|BL_ORD_ID|2404_2611+2700_71-90
- gnl|BL_ORD_ID|2314_13778+13867_71-90
- gnl|BL_ORD_ID|2314_13778-13867_1-20
- gnl|BL_ORD_ID|1188_62445+62548_85-104