PLAZA 3.0 Dicots : Binding Sites

Binding site page : Motif_647

Identifier: Motif_647
Name: TEF1BOXATA1
Description: tef1 box found in the Arabidopsis EF-1 alpha A1 gene promoter; Conserved in the A.t. EF-1 alpha gene promoters; Involved in the activation of EF-1 alpha gene; Involved in the transcriptional activation of plant genes that are overexpressed in cycling cells; Conserved in the promoters of genes for products related to the translational apparatus

Number of genes: 0
Sequence: ACAGGGGCATAATGGTAATTTAAA
Positional Weight Matrix

Binding site distribution per species

Binding site distribition per location

Toolbox

Explore

... associated Gene Ontology annotation of this binding site.
... associated InterPro annotation of this binding site.
... associated MapMan annotation of this binding site.

View

... the associated gene families.
... the binding sites with a similar sequence.

Gene List

Index of genes with 1 constraints:

Binding site : Motif_647

There are no genes matching these requirements !