Binding site page : Motif_597
- Identifier
- Motif_597
- Name
- SUREAHVISO1
- Description
- SURE-a; Sugar-responsive element found in barley iso1 (encoding isoamylase1) promoter at -597 to -573; Highly similar to SURE of potato class-1 putative promoter; SUSIBA2 (WRKY transcription factor) binding site
- Number of genes
- 0
- Sequence
- AAAACTAAGAAAGACCGATGGAAAA
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_597
There are no genes matching these requirements !