Binding site page : Motif_460
- Identifier
- Motif_460
- Name
- ELEMENT1GMLBC3
- Description
- Element 1 found in the promoter of soybean leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Located at -223 to -246; Element 1 and Element 2 bind to the same nodule specific factor; Element 1 and Element 2 share a common motif
- Number of genes
- 0
- Sequence
- GATATATTAATATTTTATTTTATA
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_460
There are no genes matching these requirements !