Binding site page : Motif_215
- Identifier
- Motif_215
- Name
- AGTACSAO
- Description
- AGTA repeat in pumpkin ascorbate oxidase gene (AO) promoter; Found in silencer region; AOBP (AGTA repeat binding protein) binding site; AOBP protein has DOF domain; Required for repression of expression of AO gene
- Number of genes
- 0
- Sequence
- AAAAAGTAAAAAGTAAAAAAGTAAAAAG
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_215
There are no genes matching these requirements !