IGR sequence: | igr3097#chr5#x1=15478185#l=2723 |
---|---|
Mature miRNA sequence: | CAGCCAAGGAUGACUUGCCGG |
encoded miRNA: | MIR87c |
Precursor location: | 662 - 874 (negative strand) |
precursor length: | 213 (73 basepairs) |
MIR position: | 1 - 21 (854 - 874) |
MIR length: | 21 (19 paired bases) |
miRNA location TIGR v3: | chr5:15478846<15479058 |
miRNA location TIGR v5: | chr5:15887904<15888116 |
Folding energy: | -70.32 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** * CAGCCAAGGA UGACUUGCCG GUAGCUUGUA UUAUGAUUAC UCUAUAUUCG AUUUAUAUUA 60 :(((((-((( (((((((((( ((((((((,, ,,<<-<<<<< <<<<<<____ ________>> UGGAGAUGAU GGUUUAUAUA UAUUUACUUA UCUACAUAGU UUUAGUUGAU UUUUUUUCGU 120 >>>>>->>>> ->>,,,,,<< <<<<<-<<<< -<<<<<<<-- ---<<<-<<< -<<<<<<<<< ACGUAAUAUA AUACGAAAAA GUAUUUACUU AUUUAUAUAU GUGUGUUGGG GCAAGAAGUG 180 <_________ _>>>>>>>>> >->>>->>>- ------->>> >>>->->>>> ----->>>>> UAACCAAGCU AGCCCGGCAA GUCAUCUAUG GCU 213 >>,,)))))) )--))))))) )))))))-)) )))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2404_2610-2700_1-21
- gnl|BL_ORD_ID|2404_2609+2700_72-92
- gnl|BL_ORD_ID|2314_13777+13868_72-92
- gnl|BL_ORD_ID|2314_13778-13868_1-21
- gnl|BL_ORD_ID|1188_62443+62548_86-106