IGR sequence: | igr3097#chr5#x1=15478185#l=2723 |
---|---|
Mature miRNA sequence: | UACCGGCAAGUCAUCCUUGGCUG |
encoded miRNA: | MIR86a |
Precursor location: | 661 - 874 (positive strand) |
precursor length: | 214 (50 basepairs) |
MIR position: | 192 - 214 (852 - 874) |
MIR length: | 23 (21 paired bases) |
miRNA location TIGR v3: | chr5:15478845>15479058 |
miRNA location TIGR v5: | chr5:15887903>15888116 |
Folding energy: | -58.00 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UAGCCAUAGA UGACUUGCCG GGCUAGCUUG GUUACACUUC UUGCCCCAAC ACACAUAUAU 60 ((((((--(( (((((((((( (--((((((( ,,,,,,,,,, ,,,,,,,,,, ,,,,<<<<<< AAAUAAGUAA AUACUUUUUC GUAUUAUAUU ACGUACGAAA AAAAAUCAAC UAAAACUAUG 120 <,,,,,,,,, ,,,,[[[[[[ [[[[______ __]]]]]]]] ]],,[[[-[[ _________] UAGAUAAGUA AAUAUAUAUA AACCAUCAUC UCCAUAAUAU AAAUCGAAUA UAGAGUAAUC 180 ]-]]],,,,, ,,>>>>>>>, ,,,,,,,,,, ,,,,,,,,,, ,,,,,,,,,, ,,[[____]] ********* ********** **** AUAAUACAAG CUACCGGCAA GUCAUCCUUG GCUG 214 ,,,,,,)))) )))))))))) ))))))--)) ))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3091_167853+167960_86-108
- gnl|BL_ORD_ID|3091_167854-167960_1-23
- gnl|BL_ORD_ID|1181_130579-130685_1-23
- gnl|BL_ORD_ID|1181_130578+130685_86-108