IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | CCUCCGUUUUAUAAUAUAAG |
encoded miRNA: | MIR4c |
Precursor location: | 329 - 538 (negative strand) |
precursor length: | 210 (69 basepairs) |
MIR position: | 1 - 20 (519 - 538) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr2:14363795<14364004 |
miRNA location TIGR v5: | chr2:14422408<14422617 |
Folding energy: | -52.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** CCUCCGUUUU AUAAUAUAAG UUGUUAUAGA CCAAAUUUUU UGUUUCACAC UAUAAAUUGU 60 :((((((((( (((((((((( (((((-(((, ,,<<<<--<< <<<_______ _>>>>>-->> UUUCAAGUUU UUAUGCAAGU UAUAUAUUAC UUUAAUACUU UAUGAUUAUU UAUAUUUUAC 120 >>,,,,,,,, ,<<<<<<-<< <<<<<<<<<< <<<,,,,,,, [[[[[____] ]]]],,,,,[ AGUCUCUUUU AUGAUUGGCU GAACUUUUUA AAAGUUAAUA UGCUUAAUAU GUGUGUUUUU 180 [[[[[[____ __]]--]]]] ],,,,,,,,, >>>>->>>>> >>-->>>>-> >>>>>,,,,, AGCUAAAACA ACUUAUAUUG UGAAACGGAG 210 ,,)))-)))) )))))))))) ))))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1301_3833+3952_101-120
- gnl|BL_ORD_ID|1301_3833-3952_1-20
- gnl|BL_ORD_ID|761_40562-40681_1-20
- gnl|BL_ORD_ID|761_40562+40681_101-120
- gnl|BL_ORD_ID|3084_54339-54571_1-20
- gnl|BL_ORD_ID|3084_54336-54571_1-20
- gnl|BL_ORD_ID|2480_88524+88676_134-153
- gnl|BL_ORD_ID|2480_88525-88676_1-20
- gnl|BL_ORD_ID|3598_152199-152326_1-20
- gnl|BL_ORD_ID|3598_152199+152326_109-128