IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | CUUAUAUUAUAAAACGGAGG |
encoded miRNA: | MIR4 |
Precursor location: | 328 - 538 (positive strand) |
precursor length: | 211 (56 basepairs) |
MIR position: | 192 - 211 (519 - 538) |
MIR length: | 20 (17 paired bases) |
miRNA location TIGR v3: | chr2:14363794>14364004 |
miRNA location TIGR v5: | chr2:14422407>14422617 |
Folding energy: | -39.97 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster021 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCUCCGUUUC ACAAUAUAAG UUGUUUUAGC UAAAAACACA CAUAUUAAGC AUAUUAACUU 60 :((((((((- (-(((((((( (((((-(((( ((((--(((( (,,,,,,,,, ,,,,,,,<<< UUAAAAAGUU CAGCCAAUCA UAAAAGAGAC UGUAAAAUAU AAAUAAUCAU AAAGUAUUAA 120 <<<_______ __________ >>>>>>,,,, ,,,,,,,<<< <<<<------ -<<<<----- AGUAAUAUAU AACUUGCAUA AAAACUUGAA AACAAUUUAU AGUGUGAAAC AAAAAAUUUG 180 -<<<<_____ ___>>>>--- --->>>>--- ---->>>>>> >)))))---- ------)))) ********* ********** * GUCUAUAACA ACUUAUAUUA UAAAACGGAG G 211 )-)))-)))) )))))))))- )-)))))))) :
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At3g55020.1 | 68410.m05644 expressed protein | 2 | 1 |
Rice homologs
- gnl|BL_ORD_ID|1301_3833+3952_101-120
- gnl|BL_ORD_ID|1301_3833-3952_1-20
- gnl|BL_ORD_ID|761_40562-40681_1-20
- gnl|BL_ORD_ID|761_40562+40681_101-120
- gnl|BL_ORD_ID|3084_54339-54571_1-20
- gnl|BL_ORD_ID|3084_54336-54571_1-20
- gnl|BL_ORD_ID|2480_88524+88676_134-153
- gnl|BL_ORD_ID|2480_88525-88676_1-20
- gnl|BL_ORD_ID|3598_152199-152326_1-20
- gnl|BL_ORD_ID|3598_152199+152326_109-128