IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | CCUCCGUUUUAUAAUAUAAGUUG |
encoded miRNA: | MIR4b |
Precursor location: | 329 - 538 (negative strand) |
precursor length: | 210 (69 basepairs) |
MIR position: | 1 - 23 (516 - 538) |
MIR length: | 23 (22 paired bases) |
miRNA location TIGR v3: | chr2:14363795<14364004 |
miRNA location TIGR v5: | chr2:14422408<14422617 |
Folding energy: | -52.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** CCUCCGUUUU AUAAUAUAAG UUGUUAUAGA CCAAAUUUUU UGUUUCACAC UAUAAAUUGU 60 :((((((((( (((((((((( (((((-(((, ,,<<<<--<< <<<_______ _>>>>>-->> UUUCAAGUUU UUAUGCAAGU UAUAUAUUAC UUUAAUACUU UAUGAUUAUU UAUAUUUUAC 120 >>,,,,,,,, ,<<<<<<-<< <<<<<<<<<< <<<,,,,,,, [[[[[____] ]]]],,,,,[ AGUCUCUUUU AUGAUUGGCU GAACUUUUUA AAAGUUAAUA UGCUUAAUAU GUGUGUUUUU 180 [[[[[[____ __]]--]]]] ],,,,,,,,, >>>>->>>>> >>-->>>>-> >>>>>,,,,, AGCUAAAACA ACUUAUAUUG UGAAACGGAG 210 ,,)))-)))) )))))))))) ))))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|433_93293-93545_1-23
- gnl|BL_ORD_ID|433_93293+93545_231-253