IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | CAACUUAUAUUAUAAAACGGAGG |
encoded miRNA: | MIR4a |
Precursor location: | 328 - 538 (positive strand) |
precursor length: | 211 (56 basepairs) |
MIR position: | 189 - 211 (516 - 538) |
MIR length: | 23 (20 paired bases) |
miRNA location TIGR v3: | chr2:14363794>14364004 |
miRNA location TIGR v5: | chr2:14422407>14422617 |
Folding energy: | -39.97 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCUCCGUUUC ACAAUAUAAG UUGUUUUAGC UAAAAACACA CAUAUUAAGC AUAUUAACUU 60 :((((((((- (-(((((((( (((((-(((( ((((--(((( (,,,,,,,,, ,,,,,,,<<< UUAAAAAGUU CAGCCAAUCA UAAAAGAGAC UGUAAAAUAU AAAUAAUCAU AAAGUAUUAA 120 <<<_______ __________ >>>>>>,,,, ,,,,,,,<<< <<<<------ -<<<<----- AGUAAUAUAU AACUUGCAUA AAAACUUGAA AACAAUUUAU AGUGUGAAAC AAAAAAUUUG 180 -<<<<_____ ___>>>>--- --->>>>--- ---->>>>>> >)))))---- ------)))) ** ********** ********** * GUCUAUAACA ACUUAUAUUA UAAAACGGAG G 211 )-)))-)))) )))))))))- )-)))))))) :
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|433_93293-93545_1-23
- gnl|BL_ORD_ID|433_93293+93545_231-253