IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUGAAACGGA |
encoded miRNA: | MIR73x |
Precursor location: | 330 - 500 (negative strand) |
precursor length: | 171 (60 basepairs) |
MIR position: | 152 - 171 (330 - 349) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr2:14363796<14363966 |
miRNA location TIGR v5: | chr2:14422409<14422579 |
Folding energy: | -38.00 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUUGUUUCAC ACUAUAAAUU GUUUUCAAGU UUUUAUGCAA GUUAUAUAUU ACUUUAAUAC 60 (((((((((( (-(((((-(( (((((--((( (--((((((- (((((((((( (((((,,,,, UUUAUGAUUA UUUAUAUUUU ACAGUCUCUU UUAUGAUUGG CUGAACUUUU UAAAAGUUAA 120 ,,<<<<<___ _>>>>>,,,, ,<<<<<<<__ ____>>-->> >>>,,,,,,, ,,))))-))) ********* ********** * UAUGCUUAAU AUGUGUGUUU UUAGCUAAAA CAACUUAUAU UGUGAAACGG A 171 ))))--)))) -))))))--- --)))))))) )))-)))))- )))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3435_76530+76667_1-20
- gnl|BL_ORD_ID|3435_76530-76667_119-138