IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUGAAACGGA |
encoded miRNA: | MIR73x |
Precursor location: | 330 - 536 (negative strand) |
precursor length: | 207 (68 basepairs) |
MIR position: | 188 - 207 (330 - 349) |
MIR length: | 20 (20 paired bases) |
miRNA location TIGR v3: | chr2:14363796<14364002 |
miRNA location TIGR v5: | chr2:14422409<14422615 |
Folding energy: | -49.40 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCCGUUUUAU AAUAUAAGUU GUUAUAGACC AAAUUUUUUG UUUCACACUA UAAAUUGUUU 60 (((((((((( (((((((((( (((-(((,,, <<<<--<<<< <________> >>>>-->>>> UCAAGUUUUU AUGCAAGUUA UAUAUUACUU UAAUACUUUA UGAUUAUUUA UAUUUUACAG 120 ,,,,,,,,,< <<<<<-<<<< <<<<<<<<<< <,,,,,,,[[ [[[____]]] ]],,,,,[[[ UCUCUUUUAU GAUUGGCUGA ACUUUUUAAA AGUUAAUAUG CUUAAUAUGU GUGUUUUUAG 180 [[[[______ ]]--]]]]], ,,,,,,,,>> >>->>>>>>> -->>>>->>> >>>,,,,,,, *** ********** ******* CUAAAACAAC UUAUAUUGUG AAACGGA 207 )))-)))))) )))))))))) )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3435_76530+76667_1-20
- gnl|BL_ORD_ID|3435_76530-76667_119-138