IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | UCCGUUUCACAAUAUAAGUU |
encoded miRNA: | MIR73w |
Precursor location: | 330 - 536 (positive strand) |
precursor length: | 207 (55 basepairs) |
MIR position: | 1 - 20 (330 - 349) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr2:14363796>14364002 |
miRNA location TIGR v5: | chr2:14422409>14422615 |
Folding energy: | -35.97 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** UCCGUUUCAC AAUAUAAGUU GUUUUAGCUA AAAACACACA UAUUAAGCAU AUUAACUUUU 60 (((((((-(- (((((((((( (((-(((((( ((--(((((, ,,,,,,,,,, ,,,,,<<<<< AAAAAGUUCA GCCAAUCAUA AAAGAGACUG UAAAAUAUAA AUAAUCAUAA AGUAUUAAAG 120 <_________ ________>> >>>>,,,,,, ,,,,,<<<<< <<-------< <<<------< UAAUAUAUAA CUUGCAUAAA AACUUGAAAA CAAUUUAUAG UGUGAAACAA AAAAUUUGGU 180 <<<_______ _>>>>----- ->>>>----- -->>>>>>>) ))))------ ----)))))- CUAUAACAAC UUAUAUUAUA AAACGGA 207 )))-)))))) )))))))-)- )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3435_76530+76667_1-20
- gnl|BL_ORD_ID|3435_76530-76667_119-138