IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUGAAACGGAG |
encoded miRNA: | MIR73v |
Precursor location: | 329 - 501 (negative strand) |
precursor length: | 173 (60 basepairs) |
MIR position: | 153 - 173 (329 - 349) |
MIR length: | 21 (18 paired bases) |
miRNA location TIGR v3: | chr2:14363795<14363967 |
miRNA location TIGR v5: | chr2:14422408<14422580 |
Folding energy: | -39.00 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUUUGUUUCA CACUAUAAAU UGUUUUCAAG UUUUUAUGCA AGUUAUAUAU UACUUUAAUA 60 :((((((((( ((-(((((-( ((((((--(( ((--(((((( -((((((((( ((((((,,,, CUUUAUGAUU AUUUAUAUUU UACAGUCUCU UUUAUGAUUG GCUGAACUUU UUAAAAGUUA 120 ,,,<<<<<__ __>>>>>,,, ,,<<<<<<<_ _____>>--> >>>>,,,,,, ,,,))))-)) ******** ********** *** AUAUGCUUAA UAUGUGUGUU UUUAGCUAAA ACAACUUAUA UUGUGAAACG GAG 173 )))))--))) )-))))))-- ---))))))) ))))-))))) -))))))))) )):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3545_40087-40227_121-141
- gnl|BL_ORD_ID|3545_40087+40227_1-21
- gnl|BL_ORD_ID|3273_63770-63918_129-149
- gnl|BL_ORD_ID|3273_63770+63918_1-21
- gnl|BL_ORD_ID|3196_76046-76177_112-132
- gnl|BL_ORD_ID|3084_165820-165892_53-73
- gnl|BL_ORD_ID|2119_136498-136607_90-110
- gnl|BL_ORD_ID|2119_136498+136607_1-21
- gnl|BL_ORD_ID|1979_168198+168340_1-21
- gnl|BL_ORD_ID|1773_120459+120596_1-21
- gnl|BL_ORD_ID|1773_120459-120596_118-138
- gnl|BL_ORD_ID|1564_17085+17227_1-21
- gnl|BL_ORD_ID|1463_10107-10248_122-142
- gnl|BL_ORD_ID|1463_10107+10248_1-21
- gnl|BL_ORD_ID|1156_28171-28243_53-73
- gnl|BL_ORD_ID|915_42896+43044_1-21
- gnl|BL_ORD_ID|915_42896-43044_129-149
- gnl|BL_ORD_ID|606_1052+1189_1-21
- gnl|BL_ORD_ID|606_1052-1189_118-138
- gnl|BL_ORD_ID|549_108253+108395_1-21
- gnl|BL_ORD_ID|367_75240-75381_122-142
- gnl|BL_ORD_ID|367_75240+75381_1-21
- gnl|BL_ORD_ID|353_38045-38156_92-112
- gnl|BL_ORD_ID|353_38045+38156_1-21
- gnl|BL_ORD_ID|317_59011+59152_1-21
- gnl|BL_ORD_ID|317_59011-59152_122-142
- gnl|BL_ORD_ID|310_22198+22309_1-21
- gnl|BL_ORD_ID|310_22198-22309_92-112
- gnl|BL_ORD_ID|62_48501-48642_122-142