IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUGAAACGGAGA |
encoded miRNA: | MIR73r |
Precursor location: | 328 - 502 (negative strand) |
precursor length: | 175 (62 basepairs) |
MIR position: | 154 - 175 (328 - 349) |
MIR length: | 22 (20 paired bases) |
miRNA location TIGR v3: | chr2:14363794<14363968 |
miRNA location TIGR v5: | chr2:14422407<14422581 |
Folding energy: | -39.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUUUUGUUUC ACACUAUAAA UUGUUUUCAA GUUUUUAUGC AAGUUAUAUA UUACUUUAAU 60 (((((((((( (((-(((((- (((((((--( (((--((((( (-(((((((( (((((((,,, ACUUUAUGAU UAUUUAUAUU UUACAGUCUC UUUUAUGAUU GGCUGAACUU UUUAAAAGUU 120 ,,,,<<<<<_ ___>>>>>,, ,,,<<<<<<< ______>>-- >>>>>,,,,, ,,,,))))-) ******* ********** ***** AAUAUGCUUA AUAUGUGUGU UUUUAGCUAA AACAACUUAU AUUGUGAAAC GGAGA 175 ))))))--)) ))-))))))- ----)))))) )))))-)))) )-)))))))) )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2406_138463-138605_122-143
- gnl|BL_ORD_ID|2406_138463+138606_1-22
- gnl|BL_ORD_ID|2303_30562-30704_122-143
- gnl|BL_ORD_ID|2303_30562+30705_1-22