IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUGAAACGGAGA |
encoded miRNA: | MIR73r |
Precursor location: | 328 - 537 (negative strand) |
precursor length: | 210 (69 basepairs) |
MIR position: | 189 - 210 (328 - 349) |
MIR length: | 22 (21 paired bases) |
miRNA location TIGR v3: | chr2:14363794<14364003 |
miRNA location TIGR v5: | chr2:14422407<14422616 |
Folding energy: | -53.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CUCCGUUUUA UAAUAUAAGU UGUUAUAGAC CAAAUUUUUU GUUUCACACU AUAAAUUGUU 60 (((((((((( (((((((((( ((((-(((,, ,<<<<--<<< <<________ >>>>>-->>> UUCAAGUUUU UAUGCAAGUU AUAUAUUACU UUAAUACUUU AUGAUUAUUU AUAUUUUACA 120 >,,,,,,,,, <<<<<<-<<< <<<<<<<<<< <<,,,,,,,[ [[[[____]] ]]],,,,,[[ GUCUCUUUUA UGAUUGGCUG AACUUUUUAA AAGUUAAUAU GCUUAAUAUG UGUGUUUUUA 180 [[[[[_____ _]]--]]]]] ,,,,,,,,,> >>>->>>>>> >-->>>>->> >>>>,,,,,, ** ********** ********** GCUAAAACAA CUUAUAUUGU GAAACGGAGA 210 ,)))-))))) )))))))))) ))))))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2406_138463-138605_122-143
- gnl|BL_ORD_ID|2406_138463+138606_1-22
- gnl|BL_ORD_ID|2303_30562-30704_122-143
- gnl|BL_ORD_ID|2303_30562+30705_1-22