IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | UCUCCGUUUCACAAUAUAAGUU |
encoded miRNA: | MIR73q |
Precursor location: | 328 - 538 (positive strand) |
precursor length: | 211 (56 basepairs) |
MIR position: | 1 - 22 (328 - 349) |
MIR length: | 22 (19 paired bases) |
miRNA location TIGR v3: | chr2:14363794>14364004 |
miRNA location TIGR v5: | chr2:14422407>14422617 |
Folding energy: | -39.97 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** UCUCCGUUUC ACAAUAUAAG UUGUUUUAGC UAAAAACACA CAUAUUAAGC AUAUUAACUU 60 :((((((((- (-(((((((( (((((-(((( ((((--(((( (,,,,,,,,, ,,,,,,,<<< UUAAAAAGUU CAGCCAAUCA UAAAAGAGAC UGUAAAAUAU AAAUAAUCAU AAAGUAUUAA 120 <<<_______ __________ >>>>>>,,,, ,,,,,,,<<< <<<<------ -<<<<----- AGUAAUAUAU AACUUGCAUA AAAACUUGAA AACAAUUUAU AGUGUGAAAC AAAAAAUUUG 180 -<<<<_____ ___>>>>--- --->>>>--- ---->>>>>> >)))))---- ------)))) GUCUAUAACA ACUUAUAUUA UAAAACGGAG G 211 )-)))-)))) )))))))))- )-)))))))) :
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2406_138463-138605_122-143
- gnl|BL_ORD_ID|2406_138463+138606_1-22
- gnl|BL_ORD_ID|2303_30562-30704_122-143
- gnl|BL_ORD_ID|2303_30562+30705_1-22