IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | ACUUAUAUUGUGAAACGGAGA |
encoded miRNA: | MIR73p |
Precursor location: | 328 - 537 (negative strand) |
precursor length: | 210 (69 basepairs) |
MIR position: | 190 - 210 (328 - 348) |
MIR length: | 21 (20 paired bases) |
miRNA location TIGR v3: | chr2:14363794<14364003 |
miRNA location TIGR v5: | chr2:14422407<14422616 |
Folding energy: | -53.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CUCCGUUUUA UAAUAUAAGU UGUUAUAGAC CAAAUUUUUU GUUUCACACU AUAAAUUGUU 60 (((((((((( (((((((((( ((((-(((,, ,<<<<--<<< <<________ >>>>>-->>> UUCAAGUUUU UAUGCAAGUU AUAUAUUACU UUAAUACUUU AUGAUUAUUU AUAUUUUACA 120 >,,,,,,,,, <<<<<<-<<< <<<<<<<<<< <<,,,,,,,[ [[[[____]] ]]],,,,,[[ GUCUCUUUUA UGAUUGGCUG AACUUUUUAA AAGUUAAUAU GCUUAAUAUG UGUGUUUUUA 180 [[[[[_____ _]]--]]]]] ,,,,,,,,,> >>>->>>>>> >-->>>>->> >>>>,,,,,, * ********** ********** GCUAAAACAA CUUAUAUUGU GAAACGGAGA 210 ,)))-))))) )))))))))) ))))))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3302_89851+89994_1-21
- gnl|BL_ORD_ID|3302_89851-89994_124-144
- gnl|BL_ORD_ID|3512_63786-63928_123-143
- gnl|BL_ORD_ID|3512_63786+63929_1-21
- gnl|BL_ORD_ID|3351_33503+33681_1-21
- gnl|BL_ORD_ID|3351_33503-33681_159-179
- gnl|BL_ORD_ID|2991_97803-97981_159-179
- gnl|BL_ORD_ID|2991_97803+97981_1-21
- gnl|BL_ORD_ID|2632_40326-40468_123-143
- gnl|BL_ORD_ID|2632_40326+40469_1-21
- gnl|BL_ORD_ID|2624_57492-57634_123-143
- gnl|BL_ORD_ID|2624_57492+57635_1-21
- gnl|BL_ORD_ID|2421_109585+109728_1-21
- gnl|BL_ORD_ID|2421_109585-109727_123-143
- gnl|BL_ORD_ID|1396_61736-61880_125-145
- gnl|BL_ORD_ID|1396_61736+61881_1-21
- gnl|BL_ORD_ID|1389_101273+101400_1-21
- gnl|BL_ORD_ID|1389_101273-101399_107-127
- gnl|BL_ORD_ID|1138_65491+65634_1-21
- gnl|BL_ORD_ID|1138_65491-65633_123-143
- gnl|BL_ORD_ID|986_22125-22266_122-142
- gnl|BL_ORD_ID|986_22125+22268_1-21
- gnl|BL_ORD_ID|683_70899+71048_1-21
- gnl|BL_ORD_ID|683_70899-71048_130-150
- gnl|BL_ORD_ID|346_91606-91748_123-143
- gnl|BL_ORD_ID|346_91606+91749_1-21
- gnl|BL_ORD_ID|152_111989+112132_1-21
- gnl|BL_ORD_ID|152_111989-112131_123-143