IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | CUUAUAUUGUGAAACGGAGA |
encoded miRNA: | MIR73n |
Precursor location: | 328 - 502 (negative strand) |
precursor length: | 175 (62 basepairs) |
MIR position: | 156 - 175 (328 - 347) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr2:14363794<14363968 |
miRNA location TIGR v5: | chr2:14422407<14422581 |
Folding energy: | -39.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUUUUGUUUC ACACUAUAAA UUGUUUUCAA GUUUUUAUGC AAGUUAUAUA UUACUUUAAU 60 (((((((((( (((-(((((- (((((((--( (((--((((( (-(((((((( (((((((,,, ACUUUAUGAU UAUUUAUAUU UUACAGUCUC UUUUAUGAUU GGCUGAACUU UUUAAAAGUU 120 ,,,,<<<<<_ ___>>>>>,, ,,,<<<<<<< ______>>-- >>>>>,,,,, ,,,,))))-) ***** ********** ***** AAUAUGCUUA AUAUGUGUGU UUUUAGCUAA AACAACUUAU AUUGUGAAAC GGAGA 175 ))))))--)) ))-))))))- ----)))))) )))))-)))) )-)))))))) )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2480_88524+88676_1-20
- gnl|BL_ORD_ID|2480_88524-88675_133-152
- gnl|BL_ORD_ID|3578_109411-109556_127-146
- gnl|BL_ORD_ID|3189_145298+145388_1-20
- gnl|BL_ORD_ID|3189_145298-145388_72-91