IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | UCUCCGUUUCACAAUAUAAG |
encoded miRNA: | MIR73m |
Precursor location: | 328 - 538 (positive strand) |
precursor length: | 211 (56 basepairs) |
MIR position: | 1 - 20 (328 - 347) |
MIR length: | 20 (17 paired bases) |
miRNA location TIGR v3: | chr2:14363794>14364004 |
miRNA location TIGR v5: | chr2:14422407>14422617 |
Folding energy: | -39.97 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** UCUCCGUUUC ACAAUAUAAG UUGUUUUAGC UAAAAACACA CAUAUUAAGC AUAUUAACUU 60 :((((((((- (-(((((((( (((((-(((( ((((--(((( (,,,,,,,,, ,,,,,,,<<< UUAAAAAGUU CAGCCAAUCA UAAAAGAGAC UGUAAAAUAU AAAUAAUCAU AAAGUAUUAA 120 <<<_______ __________ >>>>>>,,,, ,,,,,,,<<< <<<<------ -<<<<----- AGUAAUAUAU AACUUGCAUA AAAACUUGAA AACAAUUUAU AGUGUGAAAC AAAAAAUUUG 180 -<<<<_____ ___>>>>--- --->>>>--- ---->>>>>> >)))))---- ------)))) GUCUAUAACA ACUUAUAUUA UAAAACGGAG G 211 )-)))-)))) )))))))))- )-)))))))) :
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2480_88524+88676_1-20
- gnl|BL_ORD_ID|2480_88524-88675_133-152
- gnl|BL_ORD_ID|3578_109411-109556_127-146
- gnl|BL_ORD_ID|3189_145298+145388_1-20
- gnl|BL_ORD_ID|3189_145298-145388_72-91