IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | ACUUAUAUUGUGAAACGGAGAG |
encoded miRNA: | MIR73l |
Precursor location: | 327 - 503 (negative strand) |
precursor length: | 177 (62 basepairs) |
MIR position: | 156 - 177 (327 - 348) |
MIR length: | 22 (19 paired bases) |
miRNA location TIGR v3: | chr2:14363793<14363969 |
miRNA location TIGR v5: | chr2:14422406<14422582 |
Folding energy: | -40.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUUUUUGUUU CACACUAUAA AUUGUUUUCA AGUUUUUAUG CAAGUUAUAU AUUACUUUAA 60 :((((((((( ((((-((((( -(((((((-- ((((--(((( ((-((((((( ((((((((,, UACUUUAUGA UUAUUUAUAU UUUACAGUCU CUUUUAUGAU UGGCUGAACU UUUUAAAAGU 120 ,,,,,<<<<< ____>>>>>, ,,,,<<<<<< <______>>- ->>>>>,,,, ,,,,,))))- ***** ********** ******* UAAUAUGCUU AAUAUGUGUG UUUUUAGCUA AAACAACUUA UAUUGUGAAA CGGAGAG 177 )))))))--) )))-)))))) -----))))) ))))))-))) ))-))))))) )))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3000_153316-153461_125-146
- gnl|BL_ORD_ID|3000_153316+153460_1-22