IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | ACUUAUAUUGUGAAACGGAGAG |
encoded miRNA: | MIR73l |
Precursor location: | 327 - 539 (negative strand) |
precursor length: | 213 (69 basepairs) |
MIR position: | 192 - 213 (327 - 348) |
MIR length: | 22 (20 paired bases) |
miRNA location TIGR v3: | chr2:14363793<14364005 |
miRNA location TIGR v5: | chr2:14422406<14422618 |
Folding energy: | -53.40 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCCUCCGUUU UAUAAUAUAA GUUGUUAUAG ACCAAAUUUU UUGUUUCACA CUAUAAAUUG 60 ::(((((((( (((((((((( ((((((-((( ,,,<<<<--< <<<<______ __>>>>>--> UUUUCAAGUU UUUAUGCAAG UUAUAUAUUA CUUUAAUACU UUAUGAUUAU UUAUAUUUUA 120 >>>,,,,,,, ,,<<<<<<-< <<<<<<<<<< <<<<,,,,,, ,[[[[[____ ]]]]],,,,, CAGUCUCUUU UAUGAUUGGC UGAACUUUUU AAAAGUUAAU AUGCUUAAUA UGUGUGUUUU 180 [[[[[[[___ ___]]--]]] ]],,,,,,,, ,>>>>->>>> >>>-->>>>- >>>>>>,,,, ********* ********** *** UAGCUAAAAC AACUUAUAUU GUGAAACGGA GAG 213 ,,,)))-))) )))))))))) )))))))))) )::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3000_153316-153461_125-146
- gnl|BL_ORD_ID|3000_153316+153460_1-22