IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | CUCUCCGUUUCACAAUAUAAGU |
encoded miRNA: | MIR73k |
Precursor location: | 327 - 538 (positive strand) |
precursor length: | 212 (56 basepairs) |
MIR position: | 1 - 22 (327 - 348) |
MIR length: | 22 (18 paired bases) |
miRNA location TIGR v3: | chr2:14363793>14364004 |
miRNA location TIGR v5: | chr2:14422406>14422617 |
Folding energy: | -39.97 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** CUCUCCGUUU CACAAUAUAA GUUGUUUUAG CUAAAAACAC ACAUAUUAAG CAUAUUAACU 60 ::(((((((( -(-((((((( ((((((-((( (((((--((( ((,,,,,,,, ,,,,,,,,<< UUUAAAAAGU UCAGCCAAUC AUAAAAGAGA CUGUAAAAUA UAAAUAAUCA UAAAGUAUUA 120 <<<<______ __________ _>>>>>>,,, ,,,,,,,,<< <<<<<----- --<<<<---- AAGUAAUAUA UAACUUGCAU AAAAACUUGA AAACAAUUUA UAGUGUGAAA CAAAAAAUUU 180 --<<<<____ ____>>>>-- ---->>>>-- ----->>>>> >>)))))--- -------))) GGUCUAUAAC AACUUAUAUU AUAAAACGGA GG 212 ))-)))-))) )))))))))) -)-))))))) ):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3000_153316-153461_125-146
- gnl|BL_ORD_ID|3000_153316+153460_1-22