IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUGAAACGGAGAGA |
encoded miRNA: | MIR73 |
Precursor location: | 326 - 540 (negative strand) |
precursor length: | 215 (71 basepairs) |
MIR position: | 192 - 215 (326 - 349) |
MIR length: | 24 (23 paired bases) |
miRNA location TIGR v3: | chr2:14363792<14364006 |
miRNA location TIGR v5: | chr2:14422405<14422619 |
Folding energy: | -53.60 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster003 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUCCUCCGUU UUAUAAUAUA AGUUGUUAUA GACCAAAUUU UUUGUUUCAC ACUAUAAAUU 60 :((((((((( (((((((((( (((((((-(( (,,,<<<<-- <<<<<_____ ___>>>>>-- GUUUUCAAGU UUUUAUGCAA GUUAUAUAUU ACUUUAAUAC UUUAUGAUUA UUUAUAUUUU 120 >>>>,,,,,, ,,,<<<<<<- <<<<<<<<<< <<<<<,,,,, ,,[[[[[___ _]]]]],,,, ACAGUCUCUU UUAUGAUUGG CUGAACUUUU UAAAAGUUAA UAUGCUUAAU AUGUGUGUUU 180 ,[[[[[[[__ ____]]--]] ]]],,,,,,, ,,>>>>->>> >>>>-->>>> ->>>>>>,,, ********* ********** ***** UUAGCUAAAA CAACUUAUAU UGUGAAACGG AGAGA 215 ,,,,)))-)) )))))))))) )))))))))) ))-))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At5g14930.2 | 68412.m01617 leaf senescence-associated protein (SAG101) | 4 | 1 |
Rice homologs
- gnl|BL_ORD_ID|683_71027-71180_131-154
- gnl|BL_ORD_ID|683_71027+71180_1-24
- gnl|BL_ORD_ID|3392_84263+84383_1-24
- gnl|BL_ORD_ID|3131_118260-118402_120-143
- gnl|BL_ORD_ID|3131_118260+118402_1-24