IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | ACUUAUAUUGUGAAACGGAGAGA |
encoded miRNA: | MIR73i |
Precursor location: | 326 - 540 (negative strand) |
precursor length: | 215 (71 basepairs) |
MIR position: | 193 - 215 (326 - 348) |
MIR length: | 23 (22 paired bases) |
miRNA location TIGR v3: | chr2:14363792<14364006 |
miRNA location TIGR v5: | chr2:14422405<14422619 |
Folding energy: | -53.60 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUCCUCCGUU UUAUAAUAUA AGUUGUUAUA GACCAAAUUU UUUGUUUCAC ACUAUAAAUU 60 :((((((((( (((((((((( (((((((-(( (,,,<<<<-- <<<<<_____ ___>>>>>-- GUUUUCAAGU UUUUAUGCAA GUUAUAUAUU ACUUUAAUAC UUUAUGAUUA UUUAUAUUUU 120 >>>>,,,,,, ,,,<<<<<<- <<<<<<<<<< <<<<<,,,,, ,,[[[[[___ _]]]]],,,, ACAGUCUCUU UUAUGAUUGG CUGAACUUUU UAAAAGUUAA UAUGCUUAAU AUGUGUGUUU 180 ,[[[[[[[__ ____]]--]] ]]],,,,,,, ,,>>>>->>> >>>>-->>>> ->>>>>>,,, ******** ********** ***** UUAGCUAAAA CAACUUAUAU UGUGAAACGG AGAGA 215 ,,,,)))-)) )))))))))) )))))))))) ))-))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3476_108978+109235_1-23
- gnl|BL_ORD_ID|3476_108978-109235_236-258
- gnl|BL_ORD_ID|3302_89974-90121_126-148
- gnl|BL_ORD_ID|3302_89974+90121_1-23
- gnl|BL_ORD_ID|1973_68689-68771_61-83
- gnl|BL_ORD_ID|1973_68689+68771_1-23
- gnl|BL_ORD_ID|266_113929-114054_104-126
- gnl|BL_ORD_ID|266_113929+114054_1-23
- gnl|BL_ORD_ID|502_18745-18894_128-150
- gnl|BL_ORD_ID|502_18745+18894_1-23
- gnl|BL_ORD_ID|499_111963-112112_128-150
- gnl|BL_ORD_ID|499_111963+112112_1-23
- gnl|BL_ORD_ID|1979_168264+168373_1-23
- gnl|BL_ORD_ID|1979_168264-168373_88-110
- gnl|BL_ORD_ID|3453_82397+82529_1-23
- gnl|BL_ORD_ID|3453_82397-82529_111-133
- gnl|BL_ORD_ID|3344_54852-54938_65-87
- gnl|BL_ORD_ID|3344_54852+54938_1-23