IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | UCUCUCCGUUUCACAAUAUAAGU |
encoded miRNA: | MIR73h |
Precursor location: | 326 - 540 (positive strand) |
precursor length: | 215 (58 basepairs) |
MIR position: | 1 - 23 (326 - 348) |
MIR length: | 23 (20 paired bases) |
miRNA location TIGR v3: | chr2:14363792>14364006 |
miRNA location TIGR v5: | chr2:14422405>14422619 |
Folding energy: | -40.77 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** UCUCUCCGUU UCACAAUAUA AGUUGUUUUA GCUAAAAACA CACAUAUUAA GCAUAUUAAC 60 ((-((((((( (-(-(((((( (((((((-(( ((((((--(( (((,,,,,,, ,,,,,,,,,< UUUUAAAAAG UUCAGCCAAU CAUAAAAGAG ACUGUAAAAU AUAAAUAAUC AUAAAGUAUU 120 <<<<<_____ __________ __>>>>>>,, ,,,,,,,,,< <<<<<<---- ---<<<<--- AAAGUAAUAU AUAACUUGCA UAAAAACUUG AAAACAAUUU AUAGUGUGAA ACAAAAAAUU 180 ---<<<<___ _____>>>>- ----->>>>- ------>>>> >>>)))))-- --------)) UGGUCUAUAA CAACUUAUAU UAUAAAACGG AGGAA 215 )))-)))-)) )))))))))) )-)-)))))) )))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3476_108978+109235_1-23
- gnl|BL_ORD_ID|3476_108978-109235_236-258
- gnl|BL_ORD_ID|3302_89974-90121_126-148
- gnl|BL_ORD_ID|3302_89974+90121_1-23
- gnl|BL_ORD_ID|1973_68689-68771_61-83
- gnl|BL_ORD_ID|1973_68689+68771_1-23
- gnl|BL_ORD_ID|266_113929-114054_104-126
- gnl|BL_ORD_ID|266_113929+114054_1-23
- gnl|BL_ORD_ID|502_18745-18894_128-150
- gnl|BL_ORD_ID|502_18745+18894_1-23
- gnl|BL_ORD_ID|499_111963-112112_128-150
- gnl|BL_ORD_ID|499_111963+112112_1-23
- gnl|BL_ORD_ID|1979_168264+168373_1-23
- gnl|BL_ORD_ID|1979_168264-168373_88-110
- gnl|BL_ORD_ID|3453_82397+82529_1-23
- gnl|BL_ORD_ID|3453_82397-82529_111-133
- gnl|BL_ORD_ID|3344_54852-54938_65-87
- gnl|BL_ORD_ID|3344_54852+54938_1-23