IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | CUUAUAUUGUGAAACGGAGAGA |
encoded miRNA: | MIR73g |
Precursor location: | 326 - 503 (negative strand) |
precursor length: | 178 (63 basepairs) |
MIR position: | 157 - 178 (326 - 347) |
MIR length: | 22 (19 paired bases) |
miRNA location TIGR v3: | chr2:14363792<14363969 |
miRNA location TIGR v5: | chr2:14422405<14422582 |
Folding energy: | -41.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUUUUUGUUU CACACUAUAA AUUGUUUUCA AGUUUUUAUG CAAGUUAUAU AUUACUUUAA 60 (((((((((( ((((-((((( -(((((((-- ((((--(((( ((-((((((( ((((((((,, UACUUUAUGA UUAUUUAUAU UUUACAGUCU CUUUUAUGAU UGGCUGAACU UUUUAAAAGU 120 ,,,,,<<<<< ____>>>>>, ,,,,<<<<<< <______>>- ->>>>>,,,, ,,,,,))))- **** ********** ******** UAAUAUGCUU AAUAUGUGUG UUUUUAGCUA AAACAACUUA UAUUGUGAAA CGGAGAGA 178 )))))))--) )))-)))))) -----))))) ))))))-))) ))-))))))) ))))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1728_30777-30925_128-149
- gnl|BL_ORD_ID|1728_30777+30924_1-22
- gnl|BL_ORD_ID|1180_93082-93229_127-148
- gnl|BL_ORD_ID|1180_93082+93229_1-22
- gnl|BL_ORD_ID|153_102926-103073_127-148
- gnl|BL_ORD_ID|153_102926+103073_1-22