IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | UCUCUCCGUUUCACAAUAUAAG |
encoded miRNA: | MIR73f |
Precursor location: | 326 - 540 (positive strand) |
precursor length: | 215 (58 basepairs) |
MIR position: | 1 - 22 (326 - 347) |
MIR length: | 22 (19 paired bases) |
miRNA location TIGR v3: | chr2:14363792>14364006 |
miRNA location TIGR v5: | chr2:14422405>14422619 |
Folding energy: | -40.77 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** UCUCUCCGUU UCACAAUAUA AGUUGUUUUA GCUAAAAACA CACAUAUUAA GCAUAUUAAC 60 ((-((((((( (-(-(((((( (((((((-(( ((((((--(( (((,,,,,,, ,,,,,,,,,< UUUUAAAAAG UUCAGCCAAU CAUAAAAGAG ACUGUAAAAU AUAAAUAAUC AUAAAGUAUU 120 <<<<<_____ __________ __>>>>>>,, ,,,,,,,,,< <<<<<<---- ---<<<<--- AAAGUAAUAU AUAACUUGCA UAAAAACUUG AAAACAAUUU AUAGUGUGAA ACAAAAAAUU 180 ---<<<<___ _____>>>>- ----->>>>- ------>>>> >>>)))))-- --------)) UGGUCUAUAA CAACUUAUAU UAUAAAACGG AGGAA 215 )))-)))-)) )))))))))) )-)-)))))) )))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1728_30777-30925_128-149
- gnl|BL_ORD_ID|1728_30777+30924_1-22
- gnl|BL_ORD_ID|1180_93082-93229_127-148
- gnl|BL_ORD_ID|1180_93082+93229_1-22
- gnl|BL_ORD_ID|153_102926-103073_127-148
- gnl|BL_ORD_ID|153_102926+103073_1-22