IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | UUAUAUUGUGAAACGGAGAGA |
encoded miRNA: | MIR73e |
Precursor location: | 326 - 540 (negative strand) |
precursor length: | 215 (71 basepairs) |
MIR position: | 195 - 215 (326 - 346) |
MIR length: | 21 (20 paired bases) |
miRNA location TIGR v3: | chr2:14363792<14364006 |
miRNA location TIGR v5: | chr2:14422405<14422619 |
Folding energy: | -53.60 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUCCUCCGUU UUAUAAUAUA AGUUGUUAUA GACCAAAUUU UUUGUUUCAC ACUAUAAAUU 60 :((((((((( (((((((((( (((((((-(( (,,,<<<<-- <<<<<_____ ___>>>>>-- GUUUUCAAGU UUUUAUGCAA GUUAUAUAUU ACUUUAAUAC UUUAUGAUUA UUUAUAUUUU 120 >>>>,,,,,, ,,,<<<<<<- <<<<<<<<<< <<<<<,,,,, ,,[[[[[___ _]]]]],,,, ACAGUCUCUU UUAUGAUUGG CUGAACUUUU UAAAAGUUAA UAUGCUUAAU AUGUGUGUUU 180 ,[[[[[[[__ ____]]--]] ]]],,,,,,, ,,>>>>->>> >>>>-->>>> ->>>>>>,,, ****** ********** ***** UUAGCUAAAA CAACUUAUAU UGUGAAACGG AGAGA 215 ,,,,)))-)) )))))))))) )))))))))) ))-))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2457_105554-105700_127-147
- gnl|BL_ORD_ID|2457_105554+105700_1-21
- gnl|BL_ORD_ID|2001_60643+60790_1-21
- gnl|BL_ORD_ID|2001_60643-60790_128-148
- gnl|BL_ORD_ID|1885_93283-93398_96-116
- gnl|BL_ORD_ID|1706_95264+95411_1-21
- gnl|BL_ORD_ID|1706_95264-95411_128-148
- gnl|BL_ORD_ID|1467_109407-109522_96-116
- gnl|BL_ORD_ID|1261_81199-81324_106-126
- gnl|BL_ORD_ID|1261_81199+81324_1-21