IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | CUUAUAUUGUGAAACGGAGAGAAUA |
encoded miRNA: | MIR73c |
Precursor location: | 323 - 543 (negative strand) |
precursor length: | 221 (73 basepairs) |
MIR position: | 197 - 221 (323 - 347) |
MIR length: | 25 (23 paired bases) |
miRNA location TIGR v3: | chr2:14363789<14364009 |
miRNA location TIGR v5: | chr2:14422402<14422622 |
Folding energy: | -55.80 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UAUUUCCUCC GUUUUAUAAU AUAAGUUGUU AUAGACCAAA UUUUUUGUUU CACACUAUAA 60 ((((--(((( (((((((((( (((((((((( -(((,,,<<< <--<<<<<__ ______>>>> AUUGUUUUCA AGUUUUUAUG CAAGUUAUAU AUUACUUUAA UACUUUAUGA UUAUUUAUAU 120 >-->>>>,,, ,,,,,,<<<< <<-<<<<<<< <<<<<<<<,, ,,,,,[[[[[ ____]]]]], UUUACAGUCU CUUUUAUGAU UGGCUGAACU UUUUAAAAGU UAAUAUGCUU AAUAUGUGUG 180 ,,,,[[[[[[ [______]]- -]]]]],,,, ,,,,,>>>>- >>>>>>>--> >>>->>>>>> **** ********** ********** * UUUUUAGCUA AAACAACUUA UAUUGUGAAA CGGAGAGAAU A 221 ,,,,,,,))) -))))))))) )))))))))) )))))--))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1135_75593-75942_326-350