IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | UAUUCUCUCCGUUUCACAAUAUAAG |
encoded miRNA: | MIR73b |
Precursor location: | 323 - 543 (positive strand) |
precursor length: | 221 (60 basepairs) |
MIR position: | 1 - 25 (323 - 347) |
MIR length: | 25 (21 paired bases) |
miRNA location TIGR v3: | chr2:14363789>14364009 |
miRNA location TIGR v5: | chr2:14422402>14422622 |
Folding energy: | -42.47 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ***** UAUUCUCUCC GUUUCACAAU AUAAGUUGUU UUAGCUAAAA ACACACAUAU UAAGCAUAUU 60 ((((--(((( ((((-(-((( (((((((((( -((((((((- -(((((,,,, ,,,,,,,,,, AACUUUUAAA AAGUUCAGCC AAUCAUAAAA GAGACUGUAA AAUAUAAAUA AUCAUAAAGU 120 ,,<<<<<<__ __________ _____>>>>> >,,,,,,,,, ,,<<<<<<<- ------<<<< AUUAAAGUAA UAUAUAACUU GCAUAAAAAC UUGAAAACAA UUUAUAGUGU GAAACAAAAA 180 ------<<<< ________>> >>------>> >>-------> >>>>>>)))) )--------- AUUUGGUCUA UAACAACUUA UAUUAUAAAA CGGAGGAAAU A 221 -)))))-))) -))))))))) ))))-)-))) )))))--))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1135_75593-75942_326-350