IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | AUUGUGAAACGGAGAGAAUAUU |
encoded miRNA: | MIR72 |
Precursor location: | 321 - 545 (negative strand) |
precursor length: | 225 (75 basepairs) |
MIR position: | 204 - 225 (321 - 342) |
MIR length: | 22 (20 paired bases) |
miRNA location TIGR v3: | chr2:14363787<14364011 |
miRNA location TIGR v5: | chr2:14422400<14422624 |
Folding energy: | -58.20 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster012 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GAUAUUUCCU CCGUUUUAUA AUAUAAGUUG UUAUAGACCA AAUUUUUUGU UUCACACUAU 60 ((((((--(( (((((((((( (((((((((( ((-(((,,,< <<<--<<<<< ________>> AAAUUGUUUU CAAGUUUUUA UGCAAGUUAU AUAUUACUUU AAUACUUUAU GAUUAUUUAU 120 >>>-->>>>, ,,,,,,,,<< <<<<-<<<<< <<<<<<<<<< ,,,,,,,[[[ [[____]]]] AUUUUACAGU CUCUUUUAUG AUUGGCUGAA CUUUUUAAAA GUUAAUAUGC UUAAUAUGUG 180 ],,,,,[[[[ [[[______] ]--]]]]],, ,,,,,,,>>> >->>>>>>>- ->>>>->>>> ******* ********** ***** UGUUUUUAGC UAAAACAACU UAUAUUGUGA AACGGAGAGA AUAUU 225 >>,,,,,,,) ))-))))))) )))))))))) )))))))--) )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g45670.1 | 68409.m05132 expressed protein | 3 | 2 |
2 | At2g45670.2 | 68409.m05133 expressed protein | 3 | 2 |
Rice homologs
- gnl|BL_ORD_ID|2052_58467+58571_1-22
- gnl|BL_ORD_ID|2052_58467-58571_84-105